degradujące primery? pomóżcie..

Idź do strony 1, 2  Następny
Odpowiedz  Forum BioTechnolog.pl » Laboratorium
Autor Wiadomość
natalian
Posty: 1
Wysłany: 15.12.2007, 22:30:42
Witam...
Od kilku miesięcy borykam się z obniżeniem specyficzności produktu (problem powtórzył się już wielokrotnie dla różnych sekwencji DNA). Po rozpuszczeniu primerów (TIB Molbiol) udaje się reakcję zoptymalizować, po 2-3 rozmrożeniach pojawiają się niespecyficzne prążki, po przygotowaniu ‘świeżych’ roztworów ze stocków specyficzność jest jeszcze niższa a produkt słabszy.
Zastanawiam się nad przyczynami degradacji primerów- zmieniałam wodę, zwiększyłam annealling, nic... Sad jeśli wychodzi to ‘od przypadku do przypadku’

Jak sądzicie, co może być przyczyną ? Proszę o jakąkolwiek wskazówkę..

natalian
Posty: 1
Wysłany: 15.12.2007, 22:31:32

izeczka
Posty: 47
Wysłany: 16.12.2007, 13:37:03
a manewrowałaś też stężeniem magnezu??
poszukaj tez na forum dyskusji na temat PCR może będą przydatne np http://www.biotechnolog.pl/forum/temat-1342.htm

natalian
Posty: 1
Wysłany: 16.12.2007, 13:51:59
Izeczka,

Próbowałam z magnezem, też nie pomgło.

Próbowałam ratować primery dodając Tris-EDTA, ale efekt był odwrotny-produkt słabszy i więcej niespecyficznych prążków... Shocked

Jakij wody używacie do pcr, w jakiej rozcieńczacie primery, czy może być 'zwykla' redestylowana?

arezius
Posty: 17
Wysłany: 17.12.2007, 14:15:03
Witaj!

Niestety nie mam pojęcia co może być powodem opisanego problemu zwłaszcza, że używasz rozcieńczeń roboczych przygotowanych z zamrożonych stocków. A myślałaś, że to może problem z polimerazą lub z DNA (chyba że bylo wielokrotnie używane wcześniej)?

Cytat:

Jakij wody używacie do pcr, w jakiej rozcieńczacie primery, czy może być 'zwykla' redestylowana?



Ja osobiście obecnie używam wody Gibco (obecnie Invitrogenu), ale na pracy magisterskiej używałem dejonizowanej, autoklawowanej wody i nie było żadnych problemów. Ważne żeby woda była sterylna!! Z własnego doświadczenia polecam zamawianie primerów liofilizowanych, ale z Twoich wypowiedzi wnioskuję, ze tak właśnie było.

Pozdrawiam i życzę mniej problemów w przyszłości

micropoint
Posty: 126
Wysłany: 17.12.2007, 14:41:26
Oczyść primery na żelu poliakryloamidowym. Sytuacja może byc taka ze primery już ,,walnięte'' przyszły. Po oczyszczeniu elucja strącasz i robisz PCR. Ponadto na żelu będziesz widzieć czy oprócz primerów są jakieś degradantyJesli nie wiesz jak to zrobić daj znać napisze ci szczegółowy protokół.

jakie długie masz te primery, jaki procent GC itp. Niewykluczone że masz primer-dimer albo degraduje Ci matryca a nie primer i namnażają się krótsze fragmenty. Taką sytuację zaobserwowałem sam.

natalian
Posty: 1
Wysłany: 17.12.2007, 20:23:18
Polimeraza jest ok,
jeśli chodzi o primery to ich sekwencja przedstawia się następująco:

Primer F: CTAGGTTCCTTGCGACTGCTGTGAACT (27-mer)

Primer R: TTCAAGTCACACTCAGCCTCTCTACCA (27-mer)

Zamawiałam liofilizowane, z firmy Tib Molbiol. Nie wiem czy jest to problem sekwencji, inne primery też degradowały po ok tygodniu, od kilku miesięcy nie sfiniszowałam żadnego polimorfizmu .Sad. Woda wydaje mi się najbardziej podejrzana, używam redestylowanej, szpitalnej zapożyczonej z O. Nefrologii :/

Micropoint,
nie spotkałam się nigdy z protokołem oczyszczania o jakim pisałeś. Czy mógłbyś mi go wysłać - mój adres - nznowak@wp.pl ??

natalian
Posty: 1
Wysłany: 17.12.2007, 20:50:01
Być może to ma znaczenie...niespecyficzny prążek pojawia przy ok 40-50pz, z upływem czasu drugi o zbliżonej długości. Może to primery ulegaja amplifikacji?

micropoint
Posty: 126
Wysłany: 18.12.2007, 14:46:23
hmm Sprawdziłem primery w programie oligo i nie robi się jakiś wielki primer dimer. Dziwne że na 3' końcu primerów nie ma przynajmniej jednego nukleotudu G lub C co zwiększa specyficzność ale myślę że to nie problem chociaż różne cuda się mogą robić. Jeżeli piszesz że problem ten obserwujesz w przypadku innych primerów to podejrzana jest firma i jesli to możliwe to ją zmieńcie. Wskazane jest też zrobić oczyszczanie na poliakrykloamidzie bo będziesz widzieć czy oprócz primerów masz np. zanieczyszczenia czy degrqadanty.

A robiłaś PCR na kontrolę ujemna czyli same primery bez matrycy?

Najlepiej bedzie jak oczyścisz primery.

protokół jest w ,,maniatisie''

ja oczyszczam na 8% żelu poliakryloamidowym w warunkach denaturujących 7M mocznika. Jako marker długości stosuję bromofenolblue który w takiej procentowości migruje jak 19nt także nie pozwalam mu wypłynać z zelu. Po elektroforezie zdejmuję jedną z płyt i przenoszę żel na płytke do wygaszania fluorescencji. Pod lampą UV widać prążki odpowiadające primerom które wycinam. Elucję prowadzę w buforze o końcowych stężeniach: 0,3M octan sodu ph 5,75, 0,1 mM EDTA. Elucję prowadzę w 150 mikrolach buforu przez 1,5h w temp. 25 stopni celsjusza w termobloku z wytrząsaniem co 3 minuty przy 900rpm. potem odpipetowuję bufor i powtarzam czynność także po elucji masz około 300mikroli buforu który strącam 3 objętościami 96% etanolu przez noc w -20% celsjusza.Potem wiruję 20 minut w 4stopniach celsjusza przy 14000rpm suszę osad rozpuszczam w wodzie robiępomiar i przygotowuję określone stężenie.





Jeśli to zrobisz będziesz mieć pewność że Twoje primery są czyste

natalian
Posty: 1
Wysłany: 18.12.2007, 15:03:37
micropoint napisał:


A robiłaś PCR na kontrolę ujemna czyli same primery bez matrycy?



Primery+matryca Shocked

Bardzo dziękuję!
spróbuje oczyścić primery wg Twoich wskazówek, choć nie wiem czy wyposażenia naszej pracowni w pełni na to pozwoli- niestety diagnostyka jest u nas nastawiona głównie na RFLP.

713
Posty: 1
Wysłany: 18.12.2007, 20:38:58
Przepraszam że sie w watek wcinam, ale na mój temat "proste podstawowe pytania" nikt nie zagląda a potrzebuje pilnie info, a właściwie odpowiedzi na dany problem:

Sprawdzając orientację wstawki w wektorze można zastosować do tego PCR kolonijny. Czy może ktoś wytłumaczyć jak to naprawdę w tej reakcji jest z tymi primerami. Wiem że trzeba zastosować kombinacje primera wektora i forward lub reverse primer wstawki, ale co tak naprawdę dzieje sie podczas reakcji i jakie wyniki powinniśmy zaobserwować na żelu stosując rożne substraty, tzn różne kombinacje primerów i kolonie z wektorem z poprawną orientacją wstawki i z niepoprawną?

Proszę niech wreszcie ktoś odpiszę.
Z góry dziękuję!

micropoint
Posty: 126
Wysłany: 18.12.2007, 20:45:43
jesli kontrola z samymi primerami wyjdzie tak ze bedziesz miała te prążki niespecyficzne to oznacza że raczej coś siedzi w primerach (degradacje, primer-dimer, zanieczyszczenia). Nie należy wykluczać jeszcze kwestii matrycy. Jeśli jest mocno podegradowana to primery bedą namnażać tylko fragment sekwencji przez co pojawiają się dodatkowe prążki. Można to wytłumaczyć faktem że jeśli rozmrażasz primery to rozmrażasz też matrycę do PCR.
jeśli możesz to wklej proszę zdjecie żelu z tymi niespecyficznymi produktami.


Daj znać jak poszło. Zrób najpierw kontrolę z samymi primerami bez ich oczyszczania. Jeśli nie bedzie produktu to zapewne masz podegradowaną matrycę. Szczerze powiedziawszy moja magistrantka ma teraz podobny problem jak Ty.

Nie zapomnij zeby zrobić kontrolnego PCRa innymi pipetami które nie miały styczności z matrycami do RLFP


jakby co możesz mi podesłać primery a ja Ci je oczyszczęSmile

micropoint
Posty: 126
Wysłany: 18.12.2007, 20:50:09
Zrób kontrolę z samymi primerami. Jeśli nie powstanie produkt to prawdopodobnie masz podegradowaną matrycę z której primery namnażają tylko krótkie fragmenty.

Szczerze mówiąc moja magistrantka ma podobny problem.

Pamiętaj że jeśli rozmrażasz primery to rozmrażasz tez matryce do RLFP. To może powodować degradowanie DNA.

Wymień wszystkio co się da. Począwszy od wody buforu magnezu itd. a skończywszy na pipetach bo jesli w kontroli ujemnej bedziesz miała prążki to może pochodzić to od zanieczyszczenia matrycą pipet.

daj znać jak poszło


jak nie bedziesz mogła oczyścić primerów to możesz mi je zawsze wysłać a ja Ci oczyszczęSmile

arezius
Posty: 17
Wysłany: 20.12.2007, 09:46:57
Ja od siebie mogę tylko dodać żeby zawsze wykonywać PCR z kontrolą "ślepą", cały mix ale bez matrycy. Pozwala to kontrolować czystość reakcji oraz jakość primerów.

Co do matrycy DNA sugeruję, żeby mieć jakieś odpipetowane porcje i nie zamrażać ich tylko trzymać w lodówce co pozwala ominąć degradację przy rozmrażaniu. Ja tak robię i jeszcze nigdy nie maiałem problemó z degradacja matrycy (wyizolowane DNA zawieszone jest w buforze TE). Jeżeli nic nie będzie wychodzić spróbuj zamówić primery z innej firmy i porównaj jak wychodzi, może to wina syntezy?

Pozdrawiam

natalian
Posty: 1
Wysłany: 21.12.2007, 20:21:10
Dzięki za wszystkie wskazówki Smile, sprawdzę wszystkie opcje

Oczywiście, napisze o dalszych losach moich potyczek...Wink.
Tymaczasem Wesołych Świąt i sukcesów w labie Smile)

Idź do strony 1, 2  Następny
Strona 1 z 2